Transcript: Human NM_000697.3

Homo sapiens arachidonate 12-lipoxygenase, 12S type (ALOX12), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ALOX12 (239)
Length:
2392
CDS:
70..2061

Additional Resources:

NCBI RefSeq record:
NM_000697.3
NBCI Gene record:
ALOX12 (239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416605 TGGTATGCCTGGGTCCCTAAT pLKO_005 1717 CDS 100% 10.800 15.120 N ALOX12 n/a
2 TRCN0000056567 CCAAAGGGATGACATAGTGAA pLKO.1 1518 CDS 100% 4.950 3.960 N ALOX12 n/a
3 TRCN0000430555 GATGGCCCTCAAACGTGTTTA pLKO_005 621 CDS 100% 13.200 9.240 N ALOX12 n/a
4 TRCN0000056563 GCATCGAGAGAAGGAACTGAA pLKO.1 447 CDS 100% 4.950 3.465 N ALOX12 n/a
5 TRCN0000056564 CCCAAAGCTGTGCTAAACCAA pLKO.1 1927 CDS 100% 3.000 2.100 N ALOX12 n/a
6 TRCN0000056565 CCTCCAAATATGAGATTCCAT pLKO.1 550 CDS 100% 3.000 2.100 N ALOX12 n/a
7 TRCN0000056566 GCTGACTTCATCCTTCTGGAT pLKO.1 895 CDS 100% 2.640 1.584 N ALOX12 n/a
8 TRCN0000067594 CCCTGTTTGAAGCTGACTTTA pLKO.1 884 CDS 100% 13.200 9.240 N Alox12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.