Transcript: Human NM_000704.3

Homo sapiens ATPase H+/K+ transporting subunit alpha (ATP4A), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ATP4A (495)
Length:
3721
CDS:
30..3137

Additional Resources:

NCBI RefSeq record:
NM_000704.3
NBCI Gene record:
ATP4A (495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051011 CGCTATCGAGATCGAGCATTT pLKO.1 914 CDS 100% 10.800 15.120 N ATP4A n/a
2 TRCN0000051012 GCGGGACTTGTATCCATGATT pLKO.1 1818 CDS 100% 5.625 4.500 N ATP4A n/a
3 TRCN0000417681 TCGAACTCTGCACTGACATTT pLKO_005 2491 CDS 100% 13.200 9.240 N ATP4A n/a
4 TRCN0000429584 ACAACCTGAAGAAGTCTATTG pLKO_005 2371 CDS 100% 10.800 7.560 N ATP4A n/a
5 TRCN0000429928 ACCTGGCAATCGCTCTCATTG pLKO_005 454 CDS 100% 10.800 7.560 N ATP4A n/a
6 TRCN0000429576 CCAACATCATCGCCAGCTTTA pLKO_005 526 CDS 100% 10.800 7.560 N ATP4A n/a
7 TRCN0000051008 GCCTACTCCTACTTCCAGATT pLKO.1 2613 CDS 100% 4.950 3.465 N ATP4A n/a
8 TRCN0000051010 GCAAGGCTTCTTCAGGAATAA pLKO.1 2900 CDS 100% 13.200 7.920 N ATP4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.