Transcript: Human NM_000804.4

Homo sapiens folate receptor gamma (FOLR3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FOLR3 (2352)
Length:
849
CDS:
51..788

Additional Resources:

NCBI RefSeq record:
NM_000804.4
NBCI Gene record:
FOLR3 (2352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000804.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442362 GCGCAAAGAGCGCATTCTGAA pLKO_005 422 CDS 100% 4.950 6.930 N FOLR3 n/a
2 TRCN0000434468 CTTCAAGGTCAGCAACTATAG pLKO_005 638 CDS 100% 10.800 7.560 N FOLR3 n/a
3 TRCN0000060528 CTGGGATCACTGTGGTAAGAT pLKO.1 305 CDS 100% 5.625 3.938 N FOLR3 n/a
4 TRCN0000421203 TGGACCTCAGGGATTAATGAG pLKO_005 534 CDS 100% 4.950 3.465 N FOLR3 n/a
5 TRCN0000438818 GTAAGATGGAACCCACCTGCA pLKO_005 319 CDS 100% 2.160 1.512 N FOLR3 n/a
6 TRCN0000060531 GTCAACCAGAGCTGGCGCAAA pLKO.1 408 CDS 100% 1.350 0.945 N FOLR3 n/a
7 TRCN0000416726 GTCTCGTGGGATTATTGATTC pLKO_005 764 CDS 100% 10.800 6.480 N FOLR3 n/a
8 TRCN0000421787 ACAGCTGTCTCTATGAGTGCT pLKO_005 358 CDS 100% 2.640 1.584 N FOLR3 n/a
9 TRCN0000060529 CAATGTCTGCATGAACGCCAA pLKO.1 152 CDS 100% 2.160 1.080 Y FOLR3 n/a
10 TRCN0000060530 CCGCTGCATCCAGATGTGGTT pLKO.1 671 CDS 100% 0.880 0.440 Y FOLR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000804.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.