Transcript: Human NM_000806.5

Homo sapiens gamma-aminobutyric acid type A receptor alpha1 subunit (GABRA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GABRA1 (2554)
Length:
4376
CDS:
469..1839

Additional Resources:

NCBI RefSeq record:
NM_000806.5
NBCI Gene record:
GABRA1 (2554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000806.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426817 TGTTGTTATGACCACTCATTT pLKO_005 1179 CDS 100% 13.200 18.480 N GABRA1 n/a
2 TRCN0000061150 CCTCCGGTTAAATAACCTAAT pLKO.1 798 CDS 100% 10.800 15.120 N GABRA1 n/a
3 TRCN0000061149 CCCGCTGCTATTTGGAATCTT pLKO.1 1749 CDS 100% 5.625 7.875 N GABRA1 n/a
4 TRCN0000061151 CCGACTGTCAAGAATAGCCTT pLKO.1 1728 CDS 100% 2.640 3.696 N GABRA1 n/a
5 TRCN0000061148 CCGTCATTACAAGATGAACTT pLKO.1 553 CDS 100% 4.950 3.960 N GABRA1 n/a
6 TRCN0000426972 AGTAAAGGATCCTCTTATTAA pLKO_005 1536 CDS 100% 15.000 10.500 N GABRA1 n/a
7 TRCN0000435388 GTCTACTGGGCTACGTATTTA pLKO_005 1777 CDS 100% 15.000 10.500 N GABRA1 n/a
8 TRCN0000437097 AGGATTGGGAGAGCGTGTAAC pLKO_005 645 CDS 100% 10.800 6.480 N GABRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000806.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.