Transcript: Human NM_000831.4

Homo sapiens glutamate ionotropic receptor kainate type subunit 3 (GRIK3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GRIK3 (2899)
Length:
9491
CDS:
408..3167

Additional Resources:

NCBI RefSeq record:
NM_000831.4
NBCI Gene record:
GRIK3 (2899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251647 GGCTCAATGGGAAGGATTAAC pLKO_005 1511 CDS 100% 13.200 10.560 N Grik3 n/a
2 TRCN0000425598 GGCTCAATGGGAAGGATTAAC pLKO_005 1511 CDS 100% 13.200 10.560 N GRIK3 n/a
3 TRCN0000063284 CCGTGGTCTATGACGACAGTA pLKO.1 934 CDS 100% 4.950 3.960 N GRIK3 n/a
4 TRCN0000417359 TCGGAGGAATCTTCGAGTATG pLKO_005 520 CDS 100% 10.800 7.560 N GRIK3 n/a
5 TRCN0000063283 CCAGACATCTGGATGTATGTT pLKO.1 2094 CDS 100% 5.625 3.938 N GRIK3 n/a
6 TRCN0000063286 CCCAACACAACCTTGACCTAT pLKO.1 630 CDS 100% 4.950 3.465 N GRIK3 n/a
7 TRCN0000063285 CCGACTCTCTGACAAACAGAT pLKO.1 1690 CDS 100% 4.950 3.465 N GRIK3 n/a
8 TRCN0000063287 CCGGATTCTCAATGTGGACAA pLKO.1 1253 CDS 100% 4.050 2.835 N GRIK3 n/a
9 TRCN0000251645 TCCGGATCGGAGGAATCTTTG pLKO_005 514 CDS 100% 10.800 15.120 N Grik3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.