Transcript: Human NM_000941.3

Homo sapiens cytochrome p450 oxidoreductase (POR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
POR (5447)
Length:
2446
CDS:
30..2072

Additional Resources:

NCBI RefSeq record:
NM_000941.3
NBCI Gene record:
POR (5447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046526 CACCTGTGGAAGTTGATCGAA pLKO.1 1881 CDS 100% 3.000 4.200 N POR n/a
2 TRCN0000046524 TGGCCGAAGAAGTATCTCTTT pLKO.1 85 CDS 100% 4.950 3.960 N POR n/a
3 TRCN0000046527 CCTAACCTACTGGTTCCTCTT pLKO.1 149 CDS 100% 4.050 2.835 N POR n/a
4 TRCN0000046523 GTCCAACAAGAAGCACCCATT pLKO.1 1100 CDS 100% 4.050 2.835 N POR n/a
5 TRCN0000046525 CCGGCTGAAGAGCTACGAGAA pLKO.1 830 CDS 100% 1.350 0.945 N POR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.