Transcript: Mouse NM_001001179.3

Mus musculus alpha-2-macroglobulin like 1 (A2ml1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
A2ml1 (232400)
Length:
4698
CDS:
95..4465

Additional Resources:

NCBI RefSeq record:
NM_001001179.3
NBCI Gene record:
A2ml1 (232400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448425 CCATTGCGGACAGTCAATTTC pLKO_005 789 CDS 100% 13.200 18.480 N A2ml1 n/a
2 TRCN0000448596 CTGACGCCGGAACCAATATTG pLKO_005 650 CDS 100% 13.200 18.480 N A2ml1 n/a
3 TRCN0000086920 GCGTCTCTTATCCAATGGTTA pLKO.1 3103 CDS 100% 4.950 6.930 N A2ml1 n/a
4 TRCN0000451140 TATCCATCAATATGGCTATTT pLKO_005 1927 CDS 100% 13.200 9.240 N A2ml1 n/a
5 TRCN0000086921 CCTGGACAAATCTGCTACAAA pLKO.1 3580 CDS 100% 5.625 3.938 N A2ml1 n/a
6 TRCN0000086919 CCCTGAGTATTTGGACGCTTA pLKO.1 1375 CDS 100% 4.050 2.835 N A2ml1 n/a
7 TRCN0000086922 GCCTTCTGTGTCAATGGCAAT pLKO.1 2393 CDS 100% 4.050 2.835 N A2ml1 n/a
8 TRCN0000086918 CCATCCTACCAAGAGCCTGAT pLKO.1 4541 3UTR 100% 4.050 2.430 N A2ml1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.