Transcript: Mouse NM_001001445.2

Mus musculus transient receptor potential cation channel, subfamily V, member 1 (Trpv1), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Trpv1 (193034)
Length:
3587
CDS:
253..2772

Additional Resources:

NCBI RefSeq record:
NM_001001445.2
NBCI Gene record:
Trpv1 (193034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044190 GCGCATCTTCTACTTCAACTT pLKO.1 1548 CDS 100% 4.950 6.930 N TRPV1 n/a
2 TRCN0000068741 CCATCCCTCAAGAGTTTGTTT pLKO.1 1756 CDS 100% 5.625 3.938 N Trpv1 n/a
3 TRCN0000068740 CCCACACTGAAGCTAGAAGAA pLKO.1 1216 CDS 100% 4.950 3.465 N Trpv1 n/a
4 TRCN0000068739 CCTCGTGTTCTTGTTTGGATT pLKO.1 2007 CDS 100% 4.950 3.465 N Trpv1 n/a
5 TRCN0000068738 GCCATGCTCAATCTGCACAAT pLKO.1 736 CDS 100% 4.950 3.465 N Trpv1 n/a
6 TRCN0000068742 GCTGTCTTCATCATCCTGTTA pLKO.1 2224 CDS 100% 4.950 3.465 N Trpv1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.