Transcript: Human NM_001001657.1

Homo sapiens olfactory receptor family 2 subfamily Y member 1 (OR2Y1), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
OR2Y1 (134083)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_001001657.1
NBCI Gene record:
OR2Y1 (134083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000583989 TCTACTCCCTAACTCTCTTTG pLKO_005 101 CDS 100% 10.800 7.560 N OR2Y1 n/a
2 TRCN0000186968 CCATCTACACATATCTCCAAT pLKO.1 761 CDS 100% 4.950 3.465 N OR2Y1 n/a
3 TRCN0000188006 GCACTTATTCTAGGCTCCTAT pLKO.1 631 CDS 100% 4.950 3.465 N OR2Y1 n/a
4 TRCN0000203225 GAATCACTTCTTCTGTGAGAT pLKO.1 519 CDS 100% 4.950 2.970 N Olfr10 n/a
5 TRCN0000197315 GCTCAGCTCTTCATCTACCTA pLKO.1 295 CDS 100% 3.000 1.800 N OR2Y1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.