Transcript: Human NM_001001821.1

Homo sapiens olfactory receptor family 2 subfamily T member 34 (OR2T34), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
OR2T34 (127068)
Length:
957
CDS:
1..957

Additional Resources:

NCBI RefSeq record:
NM_001001821.1
NBCI Gene record:
OR2T34 (127068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188528 CCCTCTATAAGATGCTCACGT pLKO.1 593 CDS 100% 2.640 1.584 N OR2T34 n/a
2 TRCN0000189213 GATCCAGATGTTCTTCCACCT pLKO.1 309 CDS 100% 2.160 1.296 N OR2T34 n/a
3 TRCN0000584013 GCTCTGACGTCTCCCTCTATA pLKO_005 581 CDS 100% 13.200 6.600 Y OR2T3 n/a
4 TRCN0000583996 TCAAACAGCAAGCACTGATTT pLKO_005 30 CDS 100% 13.200 6.600 Y OR2T3 n/a
5 TRCN0000583893 CCAGGTCACTGGAGATGATAC pLKO_005 267 CDS 100% 10.800 5.400 Y OR2T34 n/a
6 TRCN0000583868 GCCATGGCCTATGACCGATAT pLKO_005 364 CDS 100% 10.800 5.400 Y OR2T3 n/a
7 TRCN0000583885 TGTTTGCAGACCTCTCCATTA pLKO_005 390 CDS 100% 10.800 5.400 Y OR2T3 n/a
8 TRCN0000204608 CTGTGGGATCCAGATGTTCTT pLKO.1 303 CDS 100% 4.950 2.475 Y OR2T34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.