Transcript: Mouse NM_001001880.2

Mus musculus myelin protein zero-like 1 (Mpzl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mpzl1 (68481)
Length:
2250
CDS:
149..778

Additional Resources:

NCBI RefSeq record:
NM_001001880.2
NBCI Gene record:
Mpzl1 (68481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091519 CCAGTCATTTACGCACAGTTA pLKO.1 757 CDS 100% 4.950 6.930 N Mpzl1 n/a
2 TRCN0000091522 CATTCGATTCTCCTAACACAA pLKO.1 324 CDS 100% 4.950 3.960 N Mpzl1 n/a
3 TRCN0000091521 CTGTTCACAATGGCACCTATA pLKO.1 528 CDS 100% 10.800 7.560 N Mpzl1 n/a
4 TRCN0000091520 CCATACTCCTAAAGAAATCTT pLKO.1 268 CDS 100% 5.625 3.938 N Mpzl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.