Transcript: Mouse NM_001001881.2

Mus musculus RIKEN cDNA 2510009E07 gene (2510009E07Rik), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
2510009E07Rik (72190)
Length:
5164
CDS:
261..1007

Additional Resources:

NCBI RefSeq record:
NM_001001881.2
NBCI Gene record:
2510009E07Rik (72190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268786 TCGACAACTATCAGGTTAAAT pLKO_005 646 CDS 100% 15.000 21.000 N 2510009E07Rik n/a
2 TRCN0000268785 GCCGACTAACACCATTCAAAT pLKO_005 524 CDS 100% 13.200 10.560 N 2510009E07Rik n/a
3 TRCN0000264112 TCTGCACACGATGCCTTAATT pLKO_005 741 CDS 100% 15.000 10.500 N C3orf70 n/a
4 TRCN0000283825 TCTGCACACGATGCCTTAATT pLKO_005 741 CDS 100% 15.000 10.500 N 2510009E07Rik n/a
5 TRCN0000283797 AGTCGGATCTGGAAGTGATTG pLKO_005 964 CDS 100% 10.800 7.560 N 2510009E07Rik n/a
6 TRCN0000268738 CTTACCTAACCAAGATCTTAA pLKO_005 3845 3UTR 100% 13.200 7.920 N 2510009E07Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.