Transcript: Human NM_001001916.2

Homo sapiens olfactory receptor family 52 subfamily J member 3 (OR52J3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
OR52J3 (119679)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_001001916.2
NBCI Gene record:
OR52J3 (119679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203643 CTCATTGGCATCTCGTATGTT pLKO.1 640 CDS 100% 5.625 7.875 N OR52J3 n/a
2 TRCN0000204127 GCTCACGAGATTAACTATGGA pLKO.1 271 CDS 100% 3.000 4.200 N OR52J3 n/a
3 TRCN0000189327 CGTCTGTGCTCCACTACATTA pLKO.1 381 CDS 100% 13.200 10.560 N OR52J3 n/a
4 TRCN0000203899 CCACTATTGATTTGGCCCTTT pLKO.1 206 CDS 100% 4.050 2.835 N OR52J3 n/a
5 TRCN0000203732 CCTTCAGTCTTCTCTTTCCTT pLKO.1 763 CDS 100% 3.000 2.100 N OR52J3 n/a
6 TRCN0000188738 GCCCAGATGTTTCTGATCCAT pLKO.1 301 CDS 100% 3.000 2.100 N OR52J3 n/a
7 TRCN0000188373 CAGGCTCACATAATAGCCCAT pLKO.1 514 CDS 100% 2.160 1.512 N OR52J3 n/a
8 TRCN0000204443 CCATTCCTACTGTGAGCACAT pLKO.1 531 CDS 100% 4.050 2.430 N OR52J3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.