Transcript: Mouse NM_001001981.3

Mus musculus UTP14B small subunit processome component (Utp14b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Utp14b (195434)
Length:
3695
CDS:
481..2823

Additional Resources:

NCBI RefSeq record:
NM_001001981.3
NBCI Gene record:
Utp14b (195434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192025 CCGATCACAAGCAGCTAATAA pLKO.1 2270 CDS 100% 15.000 21.000 N Utp14b n/a
2 TRCN0000192003 CCTGATCTAGTAGCTCATATA pLKO.1 3173 3UTR 100% 13.200 18.480 N Utp14b n/a
3 TRCN0000216681 CCCAACAATGCTAAGCTAATG pLKO.1 1837 CDS 100% 10.800 15.120 N Utp14b n/a
4 TRCN0000200741 GCCATATCATTAAGCCCATAA pLKO.1 2681 CDS 100% 10.800 15.120 N Utp14b n/a
5 TRCN0000191747 GCTCAGTTAGTTTAGATAGTA pLKO.1 3141 3UTR 100% 5.625 7.875 N Utp14b n/a
6 TRCN0000215377 CAACAAGGAAAGTCATCAATC pLKO.1 1908 CDS 100% 10.800 7.560 N Utp14b n/a
7 TRCN0000215736 GAATCAAGAGTAAGAAGTATC pLKO.1 1286 CDS 100% 10.800 7.560 N Utp14b n/a
8 TRCN0000192536 GCAGCAGTTTGAAAGGACTAT pLKO.1 2580 CDS 100% 4.950 3.465 N Utp14b n/a
9 TRCN0000192535 GACCTACAGATGAATGCAGAT pLKO.1 1636 CDS 100% 4.050 2.835 N Utp14b n/a
10 TRCN0000193005 GCCAGTAACAGACCCTTTATT pLKO.1 1140 CDS 100% 15.000 9.000 N Utp14b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.