Transcript: Mouse NM_001001984.2

Mus musculus lysine (K)-specific demethylase 2A (Kdm2a), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Kdm2a (225876)
Length:
7268
CDS:
827..4312

Additional Resources:

NCBI RefSeq record:
NM_001001984.2
NBCI Gene record:
Kdm2a (225876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092172 TGCCTCATTCAGTTACGTGTT pLKO.1 2667 CDS 100% 4.050 5.670 N Kdm2a n/a
2 TRCN0000092170 GCTCCAAACCAACAAATATAA pLKO.1 955 CDS 100% 15.000 12.000 N Kdm2a n/a
3 TRCN0000092169 CGATGTCTTGTAGATAAGTTA pLKO.1 2210 CDS 100% 5.625 3.938 N Kdm2a n/a
4 TRCN0000092168 GCCGCAAAGAACTTTGTGAAT pLKO.1 3540 CDS 100% 4.950 3.465 N Kdm2a n/a
5 TRCN0000092171 CCCACAGGAATAGAAGACGAA pLKO.1 2261 CDS 100% 2.640 1.848 N Kdm2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.