Transcript: Mouse NM_001002894.2

Mus musculus NLR family, pyrin domain containing 14 (Nlrp14), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nlrp14 (76858)
Length:
3297
CDS:
107..3088

Additional Resources:

NCBI RefSeq record:
NM_001002894.2
NBCI Gene record:
Nlrp14 (76858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001002894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119700 CCTACTTATTAGTAGCGACAA pLKO.1 717 CDS 100% 0.405 0.567 N Nlrp14 n/a
2 TRCN0000119697 ACTTCCAAGTGGCAAAGTCTT pLKO.1 3125 3UTR 100% 4.950 3.960 N Nlrp14 n/a
3 TRCN0000119698 GCAATCTCTATCAGCAGTTTA pLKO.1 426 CDS 100% 13.200 9.240 N Nlrp14 n/a
4 TRCN0000119699 CCTGATAGAAATGGATCTGTA pLKO.1 1834 CDS 100% 4.950 3.465 N Nlrp14 n/a
5 TRCN0000119701 CCCTTGATCATGAATCAATTA pLKO.1 2883 CDS 100% 1.320 0.924 N Nlrp14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.