Transcript: Mouse NM_001003670.1

Mus musculus predicted gene 5414 (Gm5414), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Gm5414 (406223)
Length:
1659
CDS:
1..1659

Additional Resources:

NCBI RefSeq record:
NM_001003670.1
NBCI Gene record:
Gm5414 (406223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091838 CCTGAGGTAGAGACTCTATTT pLKO.1 589 CDS 100% 13.200 18.480 N Gm5414 n/a
2 TRCN0000091842 GCTCTTGAGTGTCAACATATA pLKO.1 1317 CDS 100% 13.200 9.240 N Gm5414 n/a
3 TRCN0000091839 GCTGAGGTCAAGACACAATAT pLKO.1 970 CDS 100% 13.200 9.240 N Gm5414 n/a
4 TRCN0000091840 GCTGCTTTCATGATCGAGAAT pLKO.1 793 CDS 100% 4.950 3.465 N Gm5414 n/a
5 TRCN0000091841 GTAGAGACTCTATTTGAGGAT pLKO.1 595 CDS 100% 2.640 1.848 N Gm5414 n/a
6 TRCN0000082892 GCACAGCAGCAGAGAATGAAT pLKO.1 746 CDS 100% 5.625 2.813 Y KRT6B n/a
7 TRCN0000062387 GCAGATCAAGACCCTCAACAA pLKO.1 462 CDS 100% 4.950 2.475 Y KRT8 n/a
8 TRCN0000082890 GCAGGAGATTGCTGAGATCAA pLKO.1 1101 CDS 100% 4.950 2.475 Y KRT6B n/a
9 TRCN0000117160 GATTGCTGAGATCAACCGCAT pLKO.1 1107 CDS 100% 2.160 1.080 Y KRT6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.