Transcript: Human NM_001003700.2

Homo sapiens ras responsive element binding protein 1 (RREB1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
RREB1 (6239)
Length:
7827
CDS:
385..4815

Additional Resources:

NCBI RefSeq record:
NM_001003700.2
NBCI Gene record:
RREB1 (6239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359236 ACAACGCGCTTGTCCACAAAC pLKO_005 1142 CDS 100% 10.800 15.120 N RREB1 n/a
2 TRCN0000022203 CGACTTAGGATTCACGGACTT pLKO.1 1230 CDS 100% 4.050 5.670 N RREB1 n/a
3 TRCN0000230005 TACCGGATCCCTCCATATTAT pLKO_005 5046 3UTR 100% 0.000 0.000 N RREB1 n/a
4 TRCN0000359237 ATTTGAGCATTAGCGTTATTT pLKO_005 5145 3UTR 100% 15.000 10.500 N RREB1 n/a
5 TRCN0000230003 CGCGACCAAGGACAGCATAAA pLKO_005 1668 CDS 100% 13.200 9.240 N RREB1 n/a
6 TRCN0000218446 AGGAGTTTGTTTGCAAGTATG pLKO_005 1028 CDS 100% 10.800 7.560 N RREB1 n/a
7 TRCN0000096612 CCTGAGAAGAAACGGGCTTAT pLKO.1 4293 CDS 100% 10.800 7.560 N Rreb1 n/a
8 TRCN0000285431 GTAGGAAGTTTCCTCGCATTT pLKO_005 1256 CDS 100% 10.800 7.560 N RREB1 n/a
9 TRCN0000257127 TAGGAAGTTTCCTCGCATTTC pLKO_005 1257 CDS 100% 10.800 7.560 N RREB1 n/a
10 TRCN0000230004 TCGAGAAGAACATCGAGTATG pLKO_005 2573 CDS 100% 10.800 7.560 N RREB1 n/a
11 TRCN0000022199 CCAGTATGTTTCAAGGAGTTT pLKO.1 1015 CDS 100% 4.950 3.465 N RREB1 n/a
12 TRCN0000022201 CCGCAAGGATATCGAGAAGAA pLKO.1 2562 CDS 100% 4.950 3.465 N RREB1 n/a
13 TRCN0000022200 CCAGGAAACGAAAGAGGAGAA pLKO.1 552 CDS 100% 4.050 2.835 N RREB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.