Transcript: Mouse NM_001004152.2

Mus musculus pregnancy-specific glycoprotein 22 (Psg22), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Psg22 (243862)
Length:
1885
CDS:
188..1615

Additional Resources:

NCBI RefSeq record:
NM_001004152.2
NBCI Gene record:
Psg22 (243862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094110 CCCTACAAATTGTGAACAGAT pLKO.1 909 CDS 100% 4.950 6.930 N Psg22 n/a
2 TRCN0000094113 CACAGTCTTCCAGATAATCTT pLKO.1 713 CDS 100% 5.625 3.938 N Psg22 n/a
3 TRCN0000094112 CAGTGGAAGAGAGATATTGTT pLKO.1 1192 CDS 100% 5.625 3.938 N Psg22 n/a
4 TRCN0000094109 CCAGTACATATTTCCATTCAT pLKO.1 1684 3UTR 100% 5.625 3.938 N Psg22 n/a
5 TRCN0000094111 GCCTCGGAATTGCATTGTATT pLKO.1 411 CDS 100% 13.200 7.920 N Psg22 n/a
6 TRCN0000065531 CCGGGAAGACACAGGATATTA pLKO.1 523 CDS 100% 15.000 7.500 Y Psg19 n/a
7 TRCN0000065530 CCAGAAGATGTGCAAACCTTT pLKO.1 1082 CDS 100% 4.950 2.475 Y Psg19 n/a
8 TRCN0000065529 CCAGAGAATCTTCGAGTCTTT pLKO.1 362 CDS 100% 4.950 2.475 Y Psg19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.