Transcript: Mouse NM_001004153.2

Mus musculus expressed sequence AU018091 (AU018091), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
AU018091 (245128)
Length:
3466
CDS:
75..2129

Additional Resources:

NCBI RefSeq record:
NM_001004153.2
NBCI Gene record:
AU018091 (245128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079518 CCACCCATAAACAGTATCATA pLKO.1 2957 3UTR 100% 5.625 7.875 N AU018091 n/a
2 TRCN0000079519 GCACTGAGTATCTTTGTGAAT pLKO.1 1914 CDS 100% 4.950 3.960 N AU018091 n/a
3 TRCN0000079520 CCAGGTCTTAAGCTCTTGTAA pLKO.1 1523 CDS 100% 5.625 3.938 N AU018091 n/a
4 TRCN0000079522 GAACCTTATGTGCCCTTTCAT pLKO.1 1243 CDS 100% 5.625 3.938 N AU018091 n/a
5 TRCN0000079521 CTGGAACTTAATACTCAACTA pLKO.1 566 CDS 100% 4.950 3.465 N AU018091 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.