Transcript: Mouse NM_001004159.2

Mus musculus C-type lectin domain family 4, member b2 (Clec4b2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Clec4b2 (381809)
Length:
1044
CDS:
31..657

Additional Resources:

NCBI RefSeq record:
NM_001004159.2
NBCI Gene record:
Clec4b2 (381809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109896 CATACAATGATAGAGCCACAT pLKO.1 497 CDS 100% 4.050 5.670 N Clec4b2 n/a
2 TRCN0000109899 GACTTTCAGATGTTGGGAATA pLKO.1 449 CDS 100% 10.800 7.560 N Clec4b2 n/a
3 TRCN0000109897 GAGCCCAACAATGACTATGAA pLKO.1 532 CDS 100% 5.625 3.938 N Clec4b2 n/a
4 TRCN0000109898 CCCAGAATAAGAGTGAGGAGA pLKO.1 329 CDS 100% 2.640 1.848 N Clec4b2 n/a
5 TRCN0000109895 GCTTATGATGAACAAGCCCAA pLKO.1 156 CDS 100% 2.160 1.512 N Clec4b2 n/a
6 TRCN0000412533 AGCCAGGAAGAGCAGGATTTC pLKO_005 388 CDS 100% 10.800 5.400 Y Clec4a2 n/a
7 TRCN0000109849 CTACTTCACTTCAACTGACTT pLKO.1 300 CDS 100% 4.950 2.475 Y Clec4a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.