Transcript: Mouse NM_001004190.3

Mus musculus zinc finger protein 560 (Zfp560), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Zfp560 (434377)
Length:
4732
CDS:
304..2568

Additional Resources:

NCBI RefSeq record:
NM_001004190.3
NBCI Gene record:
Zfp560 (434377)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095813 CACATCTAAGTAAGCATGTAA pLKO.1 1934 CDS 100% 5.625 4.500 N Zfp560 n/a
2 TRCN0000095810 CCTCCTATCTTATTGCACATT pLKO.1 2183 CDS 100% 4.950 3.465 N Zfp560 n/a
3 TRCN0000095812 CGGTGCATCCAAATTCACAAT pLKO.1 2525 CDS 100% 4.950 3.465 N Zfp560 n/a
4 TRCN0000095811 GCCATTTGTAAAGTGATTGTT pLKO.1 2569 CDS 100% 5.625 3.375 N Zfp560 n/a
5 TRCN0000095809 CCCTGAATAAACTCTATTCTA pLKO.1 2864 3UTR 100% 0.563 0.281 Y Zfp560 n/a
6 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1136 CDS 100% 5.625 2.813 Y ZNF570 n/a
7 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1141 CDS 100% 4.050 2.025 Y ZNF700 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.