Transcript: Mouse NM_001004194.2

Mus musculus NLR family, pyrin domain containing 4E (Nlrp4e), mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Mus musculus (mouse)
Gene:
Nlrp4e (446099)
Length:
3382
CDS:
91..3027

Additional Resources:

NCBI RefSeq record:
NM_001004194.2
NBCI Gene record:
Nlrp4e (446099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119711 GATTCCCTTAAGCAGAAATTT pLKO.1 448 CDS 100% 15.000 10.500 N Nlrp4e n/a
2 TRCN0000119707 ACTTGGTGTTAGCCAAATGTT pLKO.1 2426 CDS 100% 5.625 3.938 N Nlrp4e n/a
3 TRCN0000119710 TCCTCATATCACTGAGTGTAA pLKO.1 2588 CDS 100% 4.950 3.465 N Nlrp4e n/a
4 TRCN0000119708 CGCCTGTTATTTGAGTTGATT pLKO.1 2131 CDS 100% 5.625 3.375 N Nlrp4e n/a
5 TRCN0000119709 GCCAGAAAGTTTAACATCAAA pLKO.1 421 CDS 100% 5.625 2.813 Y Nlrp4e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.