Transcript: Human NM_001004316.2

Homo sapiens leucine, glutamate and lysine rich 1 (LEKR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LEKR1 (389170)
Length:
2572
CDS:
115..2193

Additional Resources:

NCBI RefSeq record:
NM_001004316.2
NBCI Gene record:
LEKR1 (389170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415971 GGCATACCTATAGATGTATTT pLKO_005 2306 3UTR 100% 13.200 18.480 N LEKR1 n/a
2 TRCN0000168116 GAATCTCGCTTGAAGAAGGAA pLKO.1 1636 CDS 100% 3.000 4.200 N LEKR1 n/a
3 TRCN0000436071 ATGACTTGTCAACAGATATAT pLKO_005 1057 CDS 100% 15.000 10.500 N LEKR1 n/a
4 TRCN0000432446 GAAGTTTGAATCCATTATTTC pLKO_005 990 CDS 100% 13.200 9.240 N LEKR1 n/a
5 TRCN0000429146 TGATAGAGTAACAGATCATTA pLKO_005 2383 3UTR 100% 13.200 9.240 N LEKR1 n/a
6 TRCN0000172568 GCTGCAGCAGTCAGTAATCAT pLKO.1 1945 CDS 100% 5.625 3.938 N LEKR1 n/a
7 TRCN0000168675 GCTTCGTGGAAGTTTACCATT pLKO.1 1884 CDS 100% 4.950 3.465 N LEKR1 n/a
8 TRCN0000166948 GAGAAGATTGAAGCAGAACTT pLKO.1 1312 CDS 100% 4.950 2.970 N LEKR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.