Transcript: Human NM_001004329.3

Homo sapiens developing brain homeobox 2 (DBX2), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DBX2 (440097)
Length:
2806
CDS:
173..1192

Additional Resources:

NCBI RefSeq record:
NM_001004329.3
NBCI Gene record:
DBX2 (440097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107287 CACTGCAAGGTGCCTTATATT pLKO.1 1119 CDS 100% 15.000 21.000 N DBX2 n/a
2 TRCN0000107289 GAGTTTCCTGATCGAGAATTT pLKO.1 280 CDS 100% 13.200 18.480 N DBX2 n/a
3 TRCN0000107286 CTTGCCATCAACTTGGGACTA pLKO.1 827 CDS 100% 4.050 3.240 N DBX2 n/a
4 TRCN0000107288 CTCCTGACACAGGACTCTAAT pLKO.1 692 CDS 100% 13.200 9.240 N DBX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004329.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.