Transcript: Human NM_001004454.1

Homo sapiens olfactory receptor family 1 subfamily L member 8 (OR1L8), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
OR1L8 (138881)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_001004454.1
NBCI Gene record:
OR1L8 (138881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187418 CTGATGAACTTCCTGTCAGAA pLKO.1 247 CDS 100% 4.950 3.465 N OR1L8 n/a
2 TRCN0000189007 GCAGATGACAGAAGCACCTAT pLKO.1 597 CDS 100% 4.950 3.465 N OR1L8 n/a
3 TRCN0000203605 CTCCAATGTTATCCACCACTT pLKO.1 513 CDS 100% 4.050 2.835 N OR1L8 n/a
4 TRCN0000188739 GCTGATGAACTTCCTGTCAGA pLKO.1 246 CDS 100% 2.640 1.848 N OR1L8 n/a
5 TRCN0000203759 CCTTCTGTGACTCCAATGTTA pLKO.1 503 CDS 100% 5.625 3.375 N OR1L8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.