Transcript: Human NM_001004490.1

Homo sapiens olfactory receptor family 2 subfamily AG member 2 (OR2AG2), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
OR2AG2 (338755)
Length:
951
CDS:
1..951

Additional Resources:

NCBI RefSeq record:
NM_001004490.1
NBCI Gene record:
OR2AG2 (338755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584282 CTCCAGGTATGAGCTTATAAT pLKO_005 576 CDS 100% 15.000 21.000 N OR2AG2 n/a
2 TRCN0000203145 GCTCTATGCTACATTTACAAT pLKO.1 78 CDS 100% 5.625 3.938 N OR2AG2 n/a
3 TRCN0000185591 CATTTGTCATCCTCTGAAATA pLKO.1 375 CDS 100% 13.200 7.920 N OR2AG2 n/a
4 TRCN0000188136 CCTATTCACTGTGCTTCGTAT pLKO.1 663 CDS 100% 4.950 2.970 N OR2AG2 n/a
5 TRCN0000204828 GACCTCCTGTTCACATCTGTT pLKO.1 208 CDS 100% 4.950 2.475 Y OR2AG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.