Transcript: Human NM_001004700.2

Homo sapiens olfactory receptor family 4 subfamily C member 11 (OR4C11), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
OR4C11 (219429)
Length:
1045
CDS:
26..958

Additional Resources:

NCBI RefSeq record:
NM_001004700.2
NBCI Gene record:
OR4C11 (219429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061699 CGCTTGCACGTCTCACATAAT pLKO.1 733 CDS 100% 13.200 18.480 N OR4C11 n/a
2 TRCN0000061701 GCCTGGATAGGGTCTTTAATA pLKO.1 461 CDS 100% 15.000 10.500 N OR4C11 n/a
3 TRCN0000360206 ACCCTATTTGATTGATCATTA pLKO_005 529 CDS 100% 13.200 9.240 N OR4C11 n/a
4 TRCN0000367988 ATTCATACTGTTAGGATTAAC pLKO_005 52 CDS 100% 13.200 9.240 N OR4C11 n/a
5 TRCN0000360205 CTTGCCTGGATAGGGTCTTTA pLKO_005 458 CDS 100% 13.200 9.240 N OR4C11 n/a
6 TRCN0000061700 CACAAGTCTTTGCACTACATT pLKO.1 315 CDS 100% 5.625 3.938 N OR4C11 n/a
7 TRCN0000061698 GCTCAGATTATCCTGGCCTTA pLKO.1 491 CDS 100% 4.050 2.835 N OR4C11 n/a
8 TRCN0000188830 GTCCTCATTCTCATGGCTGTT pLKO.1 359 CDS 100% 4.050 2.835 N Olfr1206 n/a
9 TRCN0000061702 GCTCAAGTAGTTTCATGATTT pLKO.1 639 CDS 100% 13.200 7.920 N OR4C11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.