Transcript: Human NM_001004719.2

Homo sapiens olfactory receptor family 4 subfamily M member 2 (OR4M2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
OR4M2 (390538)
Length:
1084
CDS:
99..1040

Additional Resources:

NCBI RefSeq record:
NM_001004719.2
NBCI Gene record:
OR4M2 (390538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584201 GTCTGTGTTCAATACTTTAAT pLKO_005 917 CDS 100% 15.000 10.500 N OR4M2 n/a
2 TRCN0000584628 AGGAAGTTGGTCACCAAATAT pLKO_005 999 CDS 100% 15.000 9.000 N OR4M2 n/a
3 TRCN0000583997 ATCTGGCCTTCCTTGATATTT pLKO_005 292 CDS 100% 15.000 9.000 N OR4M2 n/a
4 TRCN0000584045 CCTTTACGTAATCCCATTATT pLKO_005 942 CDS 100% 15.000 9.000 N OR4M2 n/a
5 TRCN0000583982 ATCTGACCTCTCCTATGTATT pLKO_005 259 CDS 100% 13.200 7.920 N OR4M2 n/a
6 TRCN0000203536 GTGTGTTTGATTGCTCTGTTA pLKO.1 723 CDS 100% 4.950 2.475 Y OR4M2 n/a
7 TRCN0000194274 CTACATTTATGCTCGCCCATT pLKO.1 869 CDS 100% 4.050 2.025 Y OR4M2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.