Transcript: Human NM_001004741.1

Homo sapiens olfactory receptor family 5 subfamily M member 10 (OR5M10), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
OR5M10 (390167)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_001004741.1
NBCI Gene record:
OR5M10 (390167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584187 GTTCCTGGCGATCTACCTAAT pLKO_005 90 CDS 100% 10.800 7.560 N OR5M10 n/a
2 TRCN0000583906 TTGCCATACAACAAATGATTA pLKO_005 896 CDS 100% 13.200 7.920 N OR5M10 n/a
3 TRCN0000060942 CCAACTGCAAACACCCATGTA pLKO.1 159 CDS 100% 4.950 2.970 N OR5M10 n/a
4 TRCN0000060941 GCAGCCCTTTACATTACAGTT pLKO.1 380 CDS 100% 4.950 2.970 N OR5M10 n/a
5 TRCN0000060939 GATGTCCAAGAACATTTGCAT pLKO.1 405 CDS 100% 3.000 1.800 N OR5M10 n/a
6 TRCN0000060977 CTTCCAATGTTACTCCAAATA pLKO.1 221 CDS 100% 13.200 6.600 Y OR5M1 n/a
7 TRCN0000060938 GCTCCCTTGAAATCAATCATT pLKO.1 509 CDS 100% 5.625 2.813 Y OR5M10 n/a
8 TRCN0000060940 CCACCTGACAATAGTCACTTT pLKO.1 729 CDS 100% 4.950 2.475 Y OR5M10 n/a
9 TRCN0000060975 CCTCCATCAGAGAAGTCTGTA pLKO.1 784 CDS 100% 4.950 2.475 Y OR5M1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004741.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.