Transcript: Mouse NM_001004761.1

Mus musculus G protein-coupled receptor 158 (Gpr158), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gpr158 (241263)
Length:
7143
CDS:
690..4292

Additional Resources:

NCBI RefSeq record:
NM_001004761.1
NBCI Gene record:
Gpr158 (241263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028716 GCTCATTATCACGGCTATATT pLKO.1 2549 CDS 100% 15.000 21.000 N Gpr158 n/a
2 TRCN0000028727 CCGGTCGTTATTCTGTACTTT pLKO.1 2091 CDS 100% 5.625 7.875 N Gpr158 n/a
3 TRCN0000028751 CCTTAACAACTCAGAGTGTAT pLKO.1 1682 CDS 100% 4.950 6.930 N Gpr158 n/a
4 TRCN0000028742 CGGCTATATTCCATACAATTA pLKO.1 2560 CDS 100% 13.200 10.560 N Gpr158 n/a
5 TRCN0000360101 ACCTGAACAGCAGTATCAATT pLKO_005 2773 CDS 100% 13.200 9.240 N GPR158 n/a
6 TRCN0000028697 GCCAAGTACATTTCGTTGTAT pLKO.1 2114 CDS 100% 5.625 3.938 N Gpr158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.