Transcript: Human NM_001005213.1

Homo sapiens olfactory receptor family 9 subfamily G member 1 (OR9G1), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
OR9G1 (390174)
Length:
918
CDS:
1..918

Additional Resources:

NCBI RefSeq record:
NM_001005213.1
NBCI Gene record:
OR9G1 (390174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188035 CCTGACCTCTGTCACTTTATA pLKO.1 729 CDS 100% 15.000 7.500 Y OR9G1 n/a
2 TRCN0000203933 CGTTTCTGGATCTCTGGTATT pLKO.1 197 CDS 100% 10.800 5.400 Y OR9G1 n/a
3 TRCN0000147621 GACCTCTGTCACTTTATACTA pLKO.1 732 CDS 100% 5.625 2.813 Y OR9G9 n/a
4 TRCN0000188098 CCTCATCGTGTTGATCTGTAA pLKO.1 129 CDS 100% 4.950 2.475 Y OR9G1 n/a
5 TRCN0000149103 GTCCATAAAGCTGTGTGCATT pLKO.1 405 CDS 100% 4.950 2.475 Y OR9G9 n/a
6 TRCN0000150061 CACTTTATACTATGGCTCCAT pLKO.1 741 CDS 100% 2.640 1.320 Y OR9G9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.