Transcript: Human NM_001005329.1

Homo sapiens olfactory receptor family 51 subfamily A member 4 (OR51A4), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
OR51A4 (401666)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_001005329.1
NBCI Gene record:
OR51A4 (401666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000583932 ACTGACGAACCCAATTGTTTA pLKO_005 858 CDS 100% 13.200 10.560 N OR51A4 n/a
2 TRCN0000583891 TTGTGTCAACGGAAGATTTAA pLKO_005 922 CDS 100% 15.000 9.000 N OR51A4 n/a
3 TRCN0000584246 AGCAGCTTAAGGCTCTCAATA pLKO_005 701 CDS 100% 13.200 7.920 N OR51A4 n/a
4 TRCN0000583832 TGCATGAGCCCATGTACTATT pLKO_005 170 CDS 100% 13.200 7.920 N OR51A4 n/a
5 TRCN0000194276 CCTGTTCAATGCTCCTGAAAT pLKO.1 261 CDS 100% 13.200 7.920 N OR51A4 n/a
6 TRCN0000583914 TGCCTTATGGTAGACTTTATT pLKO_005 619 CDS 100% 15.000 7.500 Y OR51A4 n/a
7 TRCN0000187121 CTAGGAAATGGCACCATTCTT pLKO.1 124 CDS 100% 5.625 2.813 Y OR51A2 n/a
8 TRCN0000188311 CACCTTCTTCTTGGTTGGGAT pLKO.1 36 CDS 100% 2.640 1.320 Y OR51A2 n/a
9 TRCN0000204711 GATCATCTTCTACCTGCCCAT pLKO.1 747 CDS 100% 2.160 1.080 Y OR51A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.