Transcript: Mouse NM_001005422.1

Mus musculus stathmin domain containing 1 (Stmnd1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Stmnd1 (380842)
Length:
1384
CDS:
98..937

Additional Resources:

NCBI RefSeq record:
NM_001005422.1
NBCI Gene record:
Stmnd1 (380842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283424 GAGCCGGAGCAAAGTATTTAG pLKO_005 472 CDS 100% 13.200 18.480 N Stmnd1 n/a
2 TRCN0000267035 TAATTGTCCAAGGAATCATAC pLKO_005 450 CDS 100% 10.800 15.120 N Stmnd1 n/a
3 TRCN0000200487 CCAGCTTACCTAAATTATGTT pLKO.1 1180 3UTR 100% 5.625 7.875 N Stmnd1 n/a
4 TRCN0000200626 CGGAGCAAAGTATTTAGAAAT pLKO.1 476 CDS 100% 13.200 10.560 N Stmnd1 n/a
5 TRCN0000215384 CATATTCTGATAACGCCATTT pLKO.1 928 CDS 100% 10.800 8.640 N Stmnd1 n/a
6 TRCN0000191575 GATTTCACAATCCAAGACATA pLKO.1 593 CDS 100% 4.950 3.960 N Stmnd1 n/a
7 TRCN0000283420 ACAACCAAGAGGACAACATAT pLKO_005 912 CDS 100% 13.200 9.240 N Stmnd1 n/a
8 TRCN0000283418 CAGGGTGGAGGTTCCATTTAC pLKO_005 736 CDS 100% 13.200 9.240 N Stmnd1 n/a
9 TRCN0000267034 CATGTTCTCCCGTAGTCTTAA pLKO_005 974 3UTR 100% 13.200 9.240 N Stmnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.