Transcript: Human NM_001005731.3

Homo sapiens integrin subunit beta 4 (ITGB4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ITGB4 (3691)
Length:
5686
CDS:
165..5423

Additional Resources:

NCBI RefSeq record:
NM_001005731.3
NBCI Gene record:
ITGB4 (3691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296114 ACGATGACAACCGACCTATTG pLKO_005 3946 CDS 100% 10.800 15.120 N ITGB4 n/a
2 TRCN0000308077 TGTACCCGTATTGCGACTATG pLKO_005 3721 CDS 100% 10.800 15.120 N ITGB4 n/a
3 TRCN0000057770 CCAGCGACTACACTATTGGAT pLKO.1 655 CDS 100% 3.000 4.200 N ITGB4 n/a
4 TRCN0000057772 CGAGGTCACATGGTGGGCTTT pLKO.1 2415 CDS 100% 1.350 1.890 N ITGB4 n/a
5 TRCN0000296113 GTGGATGAGTTCCGGAATAAA pLKO_005 801 CDS 100% 15.000 12.000 N ITGB4 n/a
6 TRCN0000296112 GAGAAGCTTCACACCTATTTC pLKO_005 1164 CDS 100% 13.200 9.240 N ITGB4 n/a
7 TRCN0000057771 GAGGGTGTCATCACCATTGAA pLKO.1 4791 CDS 100% 5.625 3.938 N ITGB4 n/a
8 TRCN0000306738 GAGGGTGTCATCACCATTGAA pLKO_005 4791 CDS 100% 5.625 3.938 N ITGB4 n/a
9 TRCN0000057768 CTCCTCAGCTACTCCATCCTT pLKO.1 5486 3UTR 100% 3.000 2.100 N ITGB4 n/a
10 TRCN0000057769 CCCATGAAGAAAGTGCTGGTT pLKO.1 3969 CDS 100% 2.640 1.584 N ITGB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.