Transcript: Mouse NM_001005854.2

Mus musculus predicted gene 609 (Gm609), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Gm609 (208166)
Length:
2122
CDS:
89..991

Additional Resources:

NCBI RefSeq record:
NM_001005854.2
NBCI Gene record:
Gm609 (208166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189554 CAAATAACATGCCCGAGCCAT pLKO.1 870 CDS 100% 2.640 3.696 N Gm609 n/a
2 TRCN0000267866 ACAGATGCCTAACCCACTATC pLKO_005 898 CDS 100% 10.800 8.640 N Gm609 n/a
3 TRCN0000267816 AGTCTGAGACATAATTGATTG pLKO_005 978 CDS 100% 10.800 8.640 N Gm609 n/a
4 TRCN0000267865 TAATGGAATAGCCTGATTATA pLKO_005 1794 3UTR 100% 15.000 10.500 N Gm609 n/a
5 TRCN0000267867 ACAAACCTGCCTCACCATTAT pLKO_005 433 CDS 100% 13.200 7.920 N Gm609 n/a
6 TRCN0000267817 ACAGAGACTGAGAACTTAATG pLKO_005 944 CDS 100% 13.200 7.920 N Gm609 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.