Transcript: Mouse NM_001005860.2

Mus musculus C-type lectin domain family 4, member a4 (Clec4a4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Clec4a4 (474145)
Length:
1107
CDS:
1..711

Additional Resources:

NCBI RefSeq record:
NM_001005860.2
NBCI Gene record:
Clec4a4 (474145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109768 CACCATACAATAAGAGTGCTA pLKO.1 548 CDS 100% 2.640 2.112 N Clec4a4 n/a
2 TRCN0000109765 CCTGAACACAAGTGCTGGTTA pLKO.1 474 CDS 100% 4.950 3.465 N Clec4a4 n/a
3 TRCN0000109766 CCAACCAAGATTGGGAACGAT pLKO.1 590 CDS 100% 3.000 2.100 N Clec4a4 n/a
4 TRCN0000109767 CCCAAAGGATTGGAAACCATT pLKO.1 321 CDS 100% 4.950 2.970 N Clec4a4 n/a
5 TRCN0000109769 GCAGGATTTCATCACCAGCAA pLKO.1 453 CDS 100% 2.640 1.584 N Clec4a4 n/a
6 TRCN0000414514 TGCTGGCAATCACATTCTTAG pLKO_005 167 CDS 100% 10.800 5.400 Y Clec4a2 n/a
7 TRCN0000077416 ACTGCTTCTTACATCCCTGAT pLKO.1 132 CDS 100% 4.050 2.025 Y Clec4a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.