Transcript: Human NM_001007524.1

Homo sapiens coagulation factor VIII associated 3 (F8A3), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
F8A3 (474384)
Length:
1116
CDS:
1..1116

Additional Resources:

NCBI RefSeq record:
NM_001007524.1
NBCI Gene record:
F8A3 (474384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254825 CTACCGGCTGGTATCGAACAA pLKO_005 75 CDS 100% 4.950 2.475 Y F8A2 n/a
2 TRCN0000371045 CTTCACCTCGTTCTGCAAGAA pLKO_005 1066 CDS 100% 4.950 2.475 Y F8A3 n/a
3 TRCN0000371101 CTTTCTGCTGCTCCAGTCTTT pLKO_005 954 CDS 100% 4.950 2.475 Y F8A3 n/a
4 TRCN0000254826 TGGTATCGAACAAGCTGAAGA pLKO_005 83 CDS 100% 4.950 2.475 Y F8A2 n/a
5 TRCN0000267500 GAAGTACTCCTGGGAGGCTTT pLKO_005 888 CDS 100% 4.050 2.025 Y F8A2 n/a
6 TRCN0000140360 GCTGGTATCGAACAAGCTGAA pLKO.1 81 CDS 100% 4.050 2.025 Y F8A1 n/a
7 TRCN0000254827 AGCTTCCCGAGGAGCTCTTTC pLKO_005 938 CDS 100% 3.600 1.800 Y F8A2 n/a
8 TRCN0000254828 CAAGCTGAAGAAGCGGTTCCT pLKO_005 93 CDS 100% 2.640 1.320 Y F8A2 n/a
9 TRCN0000371102 ACAAGCTGAAGAAGCGGTTCC pLKO_005 92 CDS 100% 2.250 1.125 Y F8A3 n/a
10 TRCN0000140359 GAACAAGCTGAAGAAGCGGTT pLKO.1 90 CDS 100% 2.160 1.080 Y F8A1 n/a
11 TRCN0000371046 CAGCTTCCCGAGGAGCTCTTT pLKO_005 937 CDS 100% 1.650 0.825 Y F8A3 n/a
12 TRCN0000267495 CCAGACCCTGGAGAAGTACTC pLKO_005 876 CDS 100% 1.350 0.675 Y F8A3 n/a
13 TRCN0000254841 CGCGCTGCTTCCTCCGAACTC pLKO_005 726 CDS 100% 0.000 0.000 Y F8A3 n/a
14 TRCN0000254842 GTTCCTGCGGAAGCCGAACGT pLKO_005 108 CDS 100% 0.000 0.000 Y F8A3 n/a
15 TRCN0000371044 TACCGGCTGGTATCGAACAAG pLKO_005 76 CDS 100% 0.000 0.000 Y F8A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.