Transcript: Human NM_001007563.3

Homo sapiens insulin like growth factor binding protein like 1 (IGFBPL1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
IGFBPL1 (347252)
Length:
3566
CDS:
31..867

Additional Resources:

NCBI RefSeq record:
NM_001007563.3
NBCI Gene record:
IGFBPL1 (347252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118164 CATGTCAATATAGCTGTCCAA pLKO.1 652 CDS 100% 2.640 3.696 N IGFBPL1 n/a
2 TRCN0000435621 CCCGAAGTGTTCACAACGTCA pLKO_005 512 CDS 100% 2.640 3.696 N IGFBPL1 n/a
3 TRCN0000434504 TTCGCTCCTGTGGTCGTCGTT pLKO_005 487 CDS 100% 0.880 1.232 N IGFBPL1 n/a
4 TRCN0000118163 CGGTTCTAGATCTGAGTAAAT pLKO.1 806 CDS 100% 13.200 10.560 N IGFBPL1 n/a
5 TRCN0000432649 ACAGCACAGTGACGGTTCTAG pLKO_005 794 CDS 100% 4.950 3.465 N IGFBPL1 n/a
6 TRCN0000118165 CCCAGTCATCACGTGGAGAAA pLKO.1 579 CDS 100% 4.950 3.465 N IGFBPL1 n/a
7 TRCN0000118162 CGGATCTTTGTGCTTCATGAA pLKO.1 921 3UTR 100% 4.950 3.465 N IGFBPL1 n/a
8 TRCN0000428233 ATTGATCATGGGATGATGGAA pLKO_005 889 3UTR 100% 3.000 2.100 N IGFBPL1 n/a
9 TRCN0000118166 CCAGTGCCATGCAGCCAACAT pLKO.1 753 CDS 100% 1.650 1.155 N IGFBPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.