Transcript: Human NM_001008226.2

Homo sapiens stabilizer of axonemal microtubules 2 (SAXO2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SAXO2 (283726)
Length:
3124
CDS:
63..1259

Additional Resources:

NCBI RefSeq record:
NM_001008226.2
NBCI Gene record:
SAXO2 (283726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149078 GCCTGTAGCAAGGATTGTAAA pLKO.1 2426 3UTR 100% 13.200 18.480 N SAXO2 n/a
2 TRCN0000149216 GCATGCTGTTAAACAGCACAA pLKO.1 793 CDS 100% 0.405 0.567 N SAXO2 n/a
3 TRCN0000434848 AGTCATCGCCTTGATTATATA pLKO_005 510 CDS 100% 15.000 10.500 N SAXO2 n/a
4 TRCN0000130284 CCAAGGCAACAGGATTCATTA pLKO.1 1670 3UTR 100% 13.200 9.240 N SAXO2 n/a
5 TRCN0000422092 TATGGCAATTGTATGGTTATT pLKO_005 1573 3UTR 100% 13.200 9.240 N SAXO2 n/a
6 TRCN0000129833 CAGCTTGAACTCAAGTTTGAA pLKO.1 537 CDS 100% 5.625 3.938 N SAXO2 n/a
7 TRCN0000128153 CAAGATTATTCCTGCAGTGAA pLKO.1 1229 CDS 100% 4.950 3.465 N SAXO2 n/a
8 TRCN0000128128 CCATCTTGACTATGTTCCATA pLKO.1 815 CDS 100% 4.950 3.465 N SAXO2 n/a
9 TRCN0000147653 GCCTACTGTGAAATTTGGAAA pLKO.1 380 CDS 100% 4.950 3.465 N SAXO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.