Transcript: Human NM_001008391.3

Homo sapiens coiled-coil domain containing 73 (CCDC73), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
CCDC73 (493860)
Length:
4032
CDS:
62..3301

Additional Resources:

NCBI RefSeq record:
NM_001008391.3
NBCI Gene record:
CCDC73 (493860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138883 GCAGGCAATCAAGACGACTAA pLKO.1 3136 CDS 100% 4.950 6.930 N CCDC73 n/a
2 TRCN0000133658 GATATAGTAATCGACCACCAT pLKO.1 2168 CDS 100% 2.640 3.696 N CCDC73 n/a
3 TRCN0000167696 GTATTACTCTACTTCTGTCTT pLKO.1 3438 3UTR 100% 4.950 3.465 N CCDC73 n/a
4 TRCN0000166841 CATTGCTTCTTCAATATCCTT pLKO.1 3491 3UTR 100% 3.000 2.100 N CCDC73 n/a
5 TRCN0000133682 GAAGGCTCATTTATAGAGGAA pLKO.1 1403 CDS 100% 2.640 1.848 N CCDC73 n/a
6 TRCN0000138119 GAGGCAGAATTGAAGGTGCTA pLKO.1 965 CDS 100% 2.640 1.848 N CCDC73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.