Transcript: Mouse NM_001008424.2

Mus musculus corneodesmosin (Cdsn), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cdsn (386463)
Length:
2678
CDS:
74..1759

Additional Resources:

NCBI RefSeq record:
NM_001008424.2
NBCI Gene record:
Cdsn (386463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001008424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251657 ATTGCTGATGGCCGGTCTTAT pLKO_005 130 CDS 100% 13.200 18.480 N Cdsn n/a
2 TRCN0000251654 GGACTTTGTGCAGACTATTTG pLKO_005 2401 3UTR 100% 13.200 18.480 N Cdsn n/a
3 TRCN0000183997 CGGTCTTATTCTGCCAGGAAT pLKO.1 142 CDS 100% 4.950 3.960 N Cdsn n/a
4 TRCN0000251655 TCTTCAGGATCCTTGATATAT pLKO_005 359 CDS 100% 15.000 10.500 N Cdsn n/a
5 TRCN0000251656 GAGCCACTTGAGAAGTCTTAA pLKO_005 1739 CDS 100% 13.200 9.240 N Cdsn n/a
6 TRCN0000251653 GGTGGCTCTGCCAACAGTTAT pLKO_005 1052 CDS 100% 13.200 9.240 N Cdsn n/a
7 TRCN0000184586 GAGAGCCACTTGAGAAGTCTT pLKO.1 1737 CDS 100% 4.950 2.970 N Cdsn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.