Transcript: Mouse NM_001008426.3

Mus musculus transmembrane epididymal protein 1B (Teddm1b), mRNA.

Source:
NCBI, updated 2014-10-18
Taxon:
Mus musculus (mouse)
Gene:
Teddm1b (433365)
Length:
2527
CDS:
103..1023

Additional Resources:

NCBI RefSeq record:
NM_001008426.3
NBCI Gene record:
Teddm1b (433365)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001008426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270329 ATGGTTGTGCAGACGTCATAA pLKO_005 431 CDS 100% 13.200 18.480 N Teddm1b n/a
2 TRCN0000270328 GCGAGGACAAGGAGTAGTATT pLKO_005 1232 3UTR 100% 13.200 18.480 N Teddm1b n/a
3 TRCN0000270364 ACCTACTCTCCTAAGAATAAA pLKO_005 223 CDS 100% 15.000 12.000 N Teddm1b n/a
4 TRCN0000270332 TGATCTCCAAGGCCGTGATAG pLKO_005 179 CDS 100% 10.800 8.640 N Teddm1b n/a
5 TRCN0000270331 ATGATGGGATGGTGTTGATTA pLKO_005 335 CDS 100% 13.200 9.240 N Teddm1b n/a
6 TRCN0000175005 GTATGTTACCTACTCTCCTAA pLKO.1 216 CDS 100% 4.950 3.465 N Teddm1b n/a
7 TRCN0000194104 GTCATAAGCAAGAACGTGCTA pLKO.1 445 CDS 100% 2.640 1.848 N Teddm1b n/a
8 TRCN0000194467 GCATGTGATGATCAACGCCTT pLKO.1 801 CDS 100% 2.160 1.296 N Teddm1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.