Transcript: Mouse NM_001008428.3

Mus musculus F-box and WD-40 domain protein 20 (Fbxw20), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Fbxw20 (434440)
Length:
1511
CDS:
53..1459

Additional Resources:

NCBI RefSeq record:
NM_001008428.3
NBCI Gene record:
Fbxw20 (434440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001008428.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193050 CCTATATCAAGCTGTTGACTA pLKO.1 498 CDS 100% 4.950 6.930 N Fbxw20 n/a
2 TRCN0000202094 CGTGTCTTGACAAAGGTCGTT pLKO.1 818 CDS 100% 2.640 1.848 N Fbxw20 n/a
3 TRCN0000192570 GCCAGAAGATTTCACTTACAA pLKO.1 304 CDS 100% 5.625 2.813 Y Fbxw20 n/a
4 TRCN0000192870 GTCGTTTACATGAACAGCTTA pLKO.1 833 CDS 100% 4.950 2.475 Y Fbxw20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008428.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.