Transcript: Human NM_001008537.3

Homo sapiens neurite extension and migration factor (NEXMIF), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NEXMIF (340533)
Length:
11717
CDS:
618..5168

Additional Resources:

NCBI RefSeq record:
NM_001008537.3
NBCI Gene record:
NEXMIF (340533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008537.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234832 TGCTAATGTTACCACTAATAT pLKO_005 3017 CDS 100% 15.000 10.500 N NEXMIF n/a
2 TRCN0000234835 TTGAGAGATGACTGGTTATTT pLKO_005 10081 3UTR 100% 15.000 10.500 N NEXMIF n/a
3 TRCN0000234834 ATGAGCACTTTAGGCAATAAC pLKO_005 4917 CDS 100% 13.200 9.240 N NEXMIF n/a
4 TRCN0000257331 CAAGGACTGTAGTCGCTATAT pLKO_005 1985 CDS 100% 13.200 9.240 N NEXMIF n/a
5 TRCN0000234833 GATGATGACCAACGGGAATTT pLKO_005 4536 CDS 100% 13.200 9.240 N NEXMIF n/a
6 TRCN0000172830 GCAGGAAGATGCCCAATTCAA pLKO.1 1604 CDS 100% 5.625 3.938 N NEXMIF n/a
7 TRCN0000166975 CCATTGAAATTTCAGCAAGTA pLKO.1 2545 CDS 100% 4.950 3.465 N NEXMIF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008537.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.