Transcript: Mouse NM_001008792.2

Mus musculus whirlin (Whrn), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Whrn (73750)
Length:
4068
CDS:
759..3494

Additional Resources:

NCBI RefSeq record:
NM_001008792.2
NBCI Gene record:
Whrn (73750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001008792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201253 GCATCCGCTAAGAACAAGAAT pLKO.1 3117 CDS 100% 5.625 7.875 N Whrn n/a
2 TRCN0000190452 GTACGGCCTTGGCATTTACAT pLKO.1 1658 CDS 100% 5.625 7.875 N Whrn n/a
3 TRCN0000192344 CCACGTAATTCTGGAAGTGAA pLKO.1 3353 CDS 100% 4.950 6.930 N Whrn n/a
4 TRCN0000192732 GAGAGAGACTACATCGACTTT pLKO.1 3444 CDS 100% 4.950 6.930 N Whrn n/a
5 TRCN0000192991 GCAAGCAGAAAGTCAGGTTAA pLKO.1 3616 3UTR 100% 10.800 7.560 N Whrn n/a
6 TRCN0000201526 CCATAACTGTGGACAGCTCAA pLKO.1 3326 CDS 100% 4.050 2.835 N Whrn n/a
7 TRCN0000190767 GAGAGTTCACACAGACTGCTT pLKO.1 3774 3UTR 100% 2.640 1.848 N Whrn n/a
8 TRCN0000217413 GTCTGTGGATGATGTCAAATC pLKO.1 2465 CDS 100% 10.800 6.480 N Whrn n/a
9 TRCN0000083354 CGGAGCTTTCTCAACATCCTA pLKO.1 1755 CDS 100% 3.000 2.100 N WHRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.