Transcript: Human NM_001008949.2

Homo sapiens ITPRIP like 1 (ITPRIPL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ITPRIPL1 (150771)
Length:
2068
CDS:
336..2003

Additional Resources:

NCBI RefSeq record:
NM_001008949.2
NBCI Gene record:
ITPRIPL1 (150771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271416 CTCCATGAGACCCAGAAATTT pLKO_005 1020 CDS 100% 15.000 10.500 N ITPRIPL1 n/a
2 TRCN0000271357 GCCCACAAGTATGACTTTAAA pLKO_005 1335 CDS 100% 15.000 10.500 N ITPRIPL1 n/a
3 TRCN0000271353 CCAAGAGGCTCACCCACAATT pLKO_005 953 CDS 100% 13.200 9.240 N ITPRIPL1 n/a
4 TRCN0000271355 CGGATGGACCTGGACACATTA pLKO_005 429 CDS 100% 13.200 9.240 N ITPRIPL1 n/a
5 TRCN0000127856 GCAAAGGTCCCTCCATCATTT pLKO.1 1793 CDS 100% 13.200 9.240 N ITPRIPL1 n/a
6 TRCN0000130371 GAAGTGTAGTAGCTCCATCAA pLKO.1 1226 CDS 100% 4.950 3.465 N ITPRIPL1 n/a
7 TRCN0000127751 GAAGCGAATGAGTGAGGAGAT pLKO.1 470 CDS 100% 4.050 2.835 N ITPRIPL1 n/a
8 TRCN0000127802 GTCACCTCTTACAACTGGCTT pLKO.1 792 CDS 100% 2.640 1.848 N ITPRIPL1 n/a
9 TRCN0000129679 CCTAAGACATTTAGGAATGCT pLKO.1 1854 CDS 100% 0.300 0.210 N ITPRIPL1 n/a
10 TRCN0000271417 TCAAGTGCCTCCAGATCATTT pLKO_005 1594 CDS 100% 13.200 7.920 N ITPRIPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.