Transcript: Human NM_001009616.4

Homo sapiens SPANX family member N5 (SPANXN5), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SPANXN5 (494197)
Length:
642
CDS:
80..298

Additional Resources:

NCBI RefSeq record:
NM_001009616.4
NBCI Gene record:
SPANXN5 (494197)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001009616.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163195 GAAGGATCTTTGATGGAGGAA pLKO.1 491 3UTR 100% 2.640 2.112 N SPANXN5 n/a
2 TRCN0000163385 GTGCTACAGGAAGACTAAGAA pLKO.1 241 CDS 100% 5.625 3.938 N SPANXN5 n/a
3 TRCN0000166379 CTTAGTCCTCGAACCGAGTTT pLKO.1 178 CDS 100% 4.950 3.465 N SPANXN5 n/a
4 TRCN0000163090 GTTGTGCTACAGGAAGACTAA pLKO.1 238 CDS 100% 4.950 3.465 N SPANXN5 n/a
5 TRCN0000165502 GTGTTGTGCTACAGGAAGACT pLKO.1 236 CDS 100% 3.000 2.100 N SPANXN5 n/a
6 TRCN0000163276 GCAGAATCTTCAAAGCAGGAT pLKO.1 374 3UTR 100% 2.640 1.848 N SPANXN5 n/a
7 TRCN0000160694 CAGGATGAAGACCTACAATTA pLKO.1 389 3UTR 100% 13.200 7.920 N SPANXN5 n/a
8 TRCN0000161690 GAATCTTCAAAGCAGGATGAA pLKO.1 377 3UTR 100% 4.950 2.970 N SPANXN5 n/a
9 TRCN0000161902 GAAGACCTACAATTACCTGAA pLKO.1 395 3UTR 100% 4.050 2.430 N SPANXN5 n/a
10 TRCN0000163700 GAAGACCTAGACTCATCTGAA pLKO.1 473 3UTR 100% 4.950 2.475 Y SPANXN5 n/a
11 TRCN0000165501 GAGACACCAAACAGGGACTTA pLKO.1 161 CDS 100% 4.950 2.475 Y SPANXN1 n/a
12 TRCN0000163920 GACTCATCTGAAGGATCTTCA pLKO.1 482 3UTR 100% 4.950 2.475 Y SPANXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009616.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.