Transcript: Human NM_001009992.1

Homo sapiens zinc finger protein 648 (ZNF648), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF648 (127665)
Length:
3649
CDS:
209..1915

Additional Resources:

NCBI RefSeq record:
NM_001009992.1
NBCI Gene record:
ZNF648 (127665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001009992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107713 ACACAAATTGTTAGGTCAGAT pLKO.1 601 CDS 100% 4.950 6.930 N ZNF648 n/a
2 TRCN0000107712 CCAGCACATACGAATGCACAA pLKO.1 1768 CDS 100% 4.050 5.670 N ZNF648 n/a
3 TRCN0000107714 CAACATGCACAGCAACAATAA pLKO.1 1273 CDS 100% 13.200 9.240 N ZNF648 n/a
4 TRCN0000107711 CCAGTGGAAATGTCTGGGAAA pLKO.1 488 CDS 100% 4.050 2.835 N ZNF648 n/a
5 TRCN0000107710 GCCCATTTACAGAGAGACATA pLKO.1 2777 3UTR 100% 4.950 2.970 N ZNF648 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.