Transcript: Human NM_001010848.4

Homo sapiens neuregulin 3 (NRG3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NRG3 (10718)
Length:
3811
CDS:
148..2238

Additional Resources:

NCBI RefSeq record:
NM_001010848.4
NBCI Gene record:
NRG3 (10718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010848.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431215 CAGAACGAGAGGCGCAATTTG pLKO_005 2174 CDS 100% 13.200 10.560 N NRG3 n/a
2 TRCN0000150772 GTAGGAATCTGTGCATTCTAT pLKO.1 2247 3UTR 100% 5.625 4.500 N NRG3 n/a
3 TRCN0000412992 GGGATAAAGCTTACCATTAAA pLKO_005 2423 3UTR 100% 15.000 10.500 N NRG3 n/a
4 TRCN0000150771 GACGTTGTCAATGTGAGTATT pLKO.1 1969 CDS 100% 13.200 9.240 N NRG3 n/a
5 TRCN0000429384 ATATCAGCAACTCGAAGAATC pLKO_005 1674 CDS 100% 10.800 7.560 N NRG3 n/a
6 TRCN0000065403 GCTGTCAATTTCATGTATCAT pLKO.1 1230 CDS 100% 5.625 3.938 N Nrg3 n/a
7 TRCN0000151123 GCAGAACAACAAGAAGTGAAA pLKO.1 2011 CDS 100% 4.950 3.465 N NRG3 n/a
8 TRCN0000155190 GAGAACTTGGTGAAGAGCCAT pLKO.1 1396 CDS 100% 2.640 1.848 N NRG3 n/a
9 TRCN0000155516 GCTCAACAGGAAAGAGAGGAA pLKO.1 2273 3UTR 100% 2.640 1.848 N NRG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010848.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.